Asksia AI LOGO

Sia

Question
Biology
Posted 12 months ago
A certain allele of a VNTR locus has the following sequence:CCTAGCCTAGCCTAG. In the space below, write out the sequence of a different allele of this same locus.
Sign in to unlock the answer
Answer from Sia
Posted 12 months ago
Answer
CCTAGCCTAGCCTAGCCTAG
Solution
a
VNTR alleles: Variable Number Tandem Repeat (VNTR) loci are regions of DNA where a short nucleotide sequence is organized as a tandem repeat. Different alleles of a VNTR locus have a different number of repeats of this sequence
b
Allele variation: Given the sequence CCTAGCCTAGCCTAG, a different allele at the same locus could have more or fewer repeats of the CCTAG sequence. For example, adding one more repeat would give the sequence CCTAGCCTAGCCTAGCCTAG
Key Concept
VNTR Allele Variation
Explanation
Different alleles at a VNTR locus vary by the number of repeats of a short nucleotide sequence.

Not the question you are looking for? Ask here!

Enter question by text

Enter question by image

Unlock Smarter Learning with AskSia Super!

Join Super, our all-in-one AI solution that can greatly improve your learning efficiency.

30% higher accuracy than GPT-4o
Entire learning journey support
The most student-friendly features
Study Other Question